Commit b164ee24 authored by Mohammed Tanash's avatar Mohammed Tanash
Browse files

Add Examples repo to the website

parent 140be4d5
*HEADING
CROSS SECTION FOR CIRCULAR DISK
REFERENCE FILE FOR: pstc38shhfs
*RESTART,WRITE
*NODE,NSET=TORUS_nset
101, 0.15, 0.0
106, 0.30, 0.0
201, 0.15, .15
206, 0.30, .15
*NGEN,NSET=NSIDE1
101, 106
*NGEN,NSET=NSIDE2
201, 206
*NSET,NSET=TORUS_nset
NSIDE1, NSIDE2
*NSET,NSET=NRIM
101, 201
*NSET,NSET=NTREAD
106, 206
***********************************
*ELEMENT,TYPE=ACAX4,ELSET=TORUS_Elset
101, 101,102,202,201
*ELGEN,ELSET=TORUS_Elset
101, 5
*ELSET,ELSET=ERIM
101,
*ELSET,ELSET=ETREAD
105,
*SOLID SECTION,MATERIAL=AIR320,ELSET=TORUS_Elset
1.0,
***********************************
*MATERIAL,NAME=AIR320
*ACOUSTICMEDIUM,BU
1.28E5,
*DENSITY
1.25,
***********************************
*STEP,INC=100
DO NOTHING
*STATIC
*BOUNDARY
TORUS_nset, 8
*NODE PRINT,FREQ=0
*EL PRINT,FREQ=0
*OUTPUT,FIELD
*NODE OUTPUT
POR,
*END STEP
Slurm submission script for Abaqus job across multiple nodes.
#!/bin/bash
#SBATCH --nodes=-4 # Use at most 4 nodes due to such a small problem size. Remove this as needed for larger problems.
#SBATCH --ntasks=16
#SBATCH --mincpus=2 # Need at least 2 CPUs (cores) per node for Abaqus to run in MPI mode
#SBATCH --mem-per-cpu=2gb
#SBATCH --time=01:00:00
#SBATCH --job-name=abaqus_test
#SBATCH --error=job.%J.err
#SBATCH --output=job.%J.out
if [[ "${SHELL}" =~ "tcsh" ]]
then
. /util/opt/lmod/lmod/init/profile
module use /util/opt/hcc-modules/Common
fi
module load abaqus/2019
source hcc_abaqus
abaqus job=exa_acrotflowaxi ask_delete=OFF interactive > exa_acrotflowaxi.txt 2>&1
*HEADING
CROSS SECTION FOR CIRCULAR DISK
REFERENCE FILE FOR: pstc38shhfs
*RESTART,WRITE
*NODE,NSET=TORUS_nset
101, 0.15, 0.0
106, 0.30, 0.0
201, 0.15, .15
206, 0.30, .15
*NGEN,NSET=NSIDE1
101, 106
*NGEN,NSET=NSIDE2
201, 206
*NSET,NSET=TORUS_nset
NSIDE1, NSIDE2
*NSET,NSET=NRIM
101, 201
*NSET,NSET=NTREAD
106, 206
***********************************
*ELEMENT,TYPE=ACAX4,ELSET=TORUS_Elset
101, 101,102,202,201
*ELGEN,ELSET=TORUS_Elset
101, 5
*ELSET,ELSET=ERIM
101,
*ELSET,ELSET=ETREAD
105,
*SOLID SECTION,MATERIAL=AIR320,ELSET=TORUS_Elset
1.0,
***********************************
*MATERIAL,NAME=AIR320
*ACOUSTICMEDIUM,BU
1.28E5,
*DENSITY
1.25,
***********************************
*STEP,INC=100
DO NOTHING
*STATIC
*BOUNDARY
TORUS_nset, 8
*NODE PRINT,FREQ=0
*EL PRINT,FREQ=0
*OUTPUT,FIELD
*NODE OUTPUT
POR,
*END STEP
+++
title = "Abaqus 2019 Example"
weight = "100"
+++
Abaqus 2019 Example
--------------------------------------
{{< readfile file="content/submitting_jobs/app_specific/job-examples/abaqus/README.md" markdown="true" >}}
{{%attachments title="Related files" style="orange" /%}}
#!/bin/bash
#SBATCH --nodes=-4 # Use at most 4 nodes due to such a small problem size. Remove this as needed for larger problems.
#SBATCH --ntasks=16
#SBATCH --mincpus=2 # Need at least 2 CPUs (cores) per node for Abaqus to run in MPI mode
#SBATCH --mem-per-cpu=2gb
#SBATCH --constraint=ib
#SBATCH --time=01:00:00
#SBATCH --job-name=abaqus_test
#SBATCH --error=job.%J.err
#SBATCH --output=job.%J.out
if [[ "${SHELL}" =~ "tcsh" ]]
then
. /util/opt/lmod/lmod/init/profile
module use /util/opt/hcc-modules/Common
fi
module load abaqus/6.14.2
source hcc_abaqus
abaqus job=exa_acrotflowaxi ask_delete=OFF interactive > exa_acrotflowaxi.txt 2>&1
*HEADING
CROSS SECTION FOR CIRCULAR DISK
REFERENCE FILE FOR: pstc38shhfs
*RESTART,WRITE
*NODE,NSET=TORUS_nset
101, 0.15, 0.0
106, 0.30, 0.0
201, 0.15, .15
206, 0.30, .15
*NGEN,NSET=NSIDE1
101, 106
*NGEN,NSET=NSIDE2
201, 206
*NSET,NSET=TORUS_nset
NSIDE1, NSIDE2
*NSET,NSET=NRIM
101, 201
*NSET,NSET=NTREAD
106, 206
***********************************
*ELEMENT,TYPE=ACAX4,ELSET=TORUS_Elset
101, 101,102,202,201
*ELGEN,ELSET=TORUS_Elset
101, 5
*ELSET,ELSET=ERIM
101,
*ELSET,ELSET=ETREAD
105,
*SOLID SECTION,MATERIAL=AIR320,ELSET=TORUS_Elset
1.0,
***********************************
*MATERIAL,NAME=AIR320
*ACOUSTICMEDIUM,BU
1.28E5,
*DENSITY
1.25,
***********************************
*STEP,INC=100
DO NOTHING
*STATIC
*BOUNDARY
TORUS_nset, 8
*NODE PRINT,FREQ=0
*EL PRINT,FREQ=0
*OUTPUT,FIELD
*NODE OUTPUT
POR,
*END STEP
+++
title = "Abaqus 6.14.2 Example"
weight = "100"
+++
Abaqus 6.14.2 Example
--------------------------------------
{{< readfile file="content/submitting_jobs/app_specific/job-examples/abaqus/README.md" markdown="true" >}}
{{%attachments title="Related files" style="orange" /%}}
# Using BLAST on HCC Clusters
This tutorial will give an overview on how to run BLAST queries on the cluster.
Created by: Natasha Pavlovikj
Example 1: Nucleotide search using a single core
- This example utilizes query sequences found in the `yeast.nt.fasta` file and searches it against the nucleotide database found in the Biodata module.
- To submit this example, use the `sbatch` command to run `blast_nt_single.submit`
Example 2: Nucleotide search using multiple cores
- This example utilizes the same query as Example 1, but requests multiple cores so the user can compare running time.
- To submit this example, use the `sbatch` command to run `blast_nt_multi.submit`
Example 3: Protein search using a custom database file
- This example uses BLAST database indexing command `makeblastdb` to create a BLAST usable database from the fasta file `yeast.aa`
- Then a protein alignment using query file `yeast.aa.fasta` is performed against the built database
- To submit this example, use the `sbatch` command to run `blast_aa_multi.submit`
Additional examples can be found within the `nucleotide` or `protein` folders.
#!/bin/bash
#SBATCH --nodes=1
#SBATCH --ntasks-per-node=2
#SBATCH --mem=5gb
#SBATCH --time=00:10:00
#SBATCH --job-name=blast_aa_multi
#SBATCH --error=blast.aa.multi.%J.err
#SBATCH --output=blast.aa.multi.%J.out
module load blast/2.10
cp yeast.aa /scratch
cp yeast.aa.fasta /scratch
makeblastdb -in /scratch/yeast.aa -dbtype prot -out /scratch/yeast.aa.db
blastp -db /scratch/yeast.aa.db -query /scratch/yeast.aa.fasta -out /scratch/blast_aa_multi.alignments -num_threads $SLURM_NTASKS_PER_NODE
cp /scratch/blast_aa_multi.alignments .
#!/bin/bash
#SBATCH --nodes=1
#SBATCH --ntasks-per-node=2
#SBATCH --mem=5gb
#SBATCH --time=01:00:00
#SBATCH --job-name=blast_nt_multi
#SBATCH --error=blast.nt.multi.%J.err
#SBATCH --output=blast.nt.multi.%J.out
module load blast/2.10
module load biodata/1.0
cp $BLAST/nt.00.n* /scratch
cp $BLAST/nt.n* /scratch
cp yeast.nt.fasta /scratch
blastn -db /scratch/nt.00 -query /scratch/yeast.nt.fasta -out /scratch/blast_nt_multi.alignments -num_threads $SLURM_NTASKS_PER_NODE
cp /scratch/blast_nt_multi.alignments .
#!/bin/bash
#SBATCH --nodes=1
#SBATCH --ntasks-per-node=1
#SBATCH --mem=5gb
#SBATCH --time=01:00:00
#SBATCH --job-name=blast_nt_single
#SBATCH --error=blast.nt.single.%J.err
#SBATCH --output=blast.nt.single.%J.out
module load blast/2.10
module load biodata/1.0
cp $BLAST/nt.00.n* /scratch
cp $BLAST/nt.n* /scratch
cp yeast.nt.fasta /scratch
blastn -db /scratch/nt.00 -query /scratch/yeast.nt.fasta -out /scratch/blast_nt_single.alignments
cp /scratch/blast_nt_single.alignments .
BLASTN 2.2.29+
Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.
Database: yeast.nt
17 sequences; 12,155,026 total letters
Query= gi|152022604|gb|CJ994915.1|CJ994915 CJ994915 normalized
Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus
cDNA clone B067-89 5', mRNA sequence
Length=556
***** No hits found *****
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.28 0.460 0.850
Effective search space used: 6478420455
Query= gi|152022603|gb|CJ994914.1|CJ994914 CJ994914 normalized
Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus
cDNA clone B067-87 5', mRNA sequence
Length=557
***** No hits found *****
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.28 0.460 0.850
Effective search space used: 6490575090
Query= gi|152022602|gb|CJ994913.1|CJ994913 CJ994913 normalized
Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus
cDNA clone B067-83 5', mRNA sequence
Length=538
Score E
Sequences producing significant alignments: (Bits) Value
gi|6319354|ref|NC_001134.1| Saccharomyces cerevisiae chromosome... 322 5e-88
> gi|6319354|ref|NC_001134.1| Saccharomyces cerevisiae chromosome
II, complete chromosome sequence
Length=813140
Score = 322 bits (174), Expect = 5e-88
Identities = 287/343 (84%), Gaps = 3/343 (1%)
Strand=Plus/Plus
Query 14 GGATTTTTNTTTACTGGTGATGGTAGCAAACCATTTCAGCAATACGTTGCAGAACTTTTA 73
|||||||| ||||| || ||||| || ||||||||||| ||||| |||| ||| | |||
Sbjct 516766 GGATTTTTGTTTACGGGCGATGGAAGTAAACCATTTCAACAATATATTGCTGAATTATTA 516825
Query 74 AATCACAATATTCCGGTATTGATCTATGCAGGTGATAAAGACTATATATGCAATTGGTTG 133
|||||||| ||||||||||| || ||||| |||||||| || ||||| || |||||| ||
Sbjct 516826 AATCACAACATTCCGGTATTAATATATGCGGGTGATAAGGATTATATTTGTAATTGGCTG 516885
Query 134 GGAAATCACGCGTGGACTAATGAACTGGAGTGGATCAATAAATCTATGTATCAGAGGAGA 193
||||| || || ||| | ||||| |||| |||||||||||| || ||||||||| ||
Sbjct 516886 GGAAACCATGCTTGGTCCAATGAGTTGGAATGGATCAATAAACGTAGGTATCAGAGAAGG 516945
Query 194 AGGTTGAGATCATGGGTTAGTGACGAAACTGGTGAAGAGTTTGGACAAGTCAAGAACTAT 253
| ||| ||| ||||||| ||| | ||||| ||||||||||| ||||||||||||||||||
Sbjct 516946 ATGTTAAGACCATGGGTCAGTAAAGAAACAGGTGAAGAGTTGGGACAAGTCAAGAACTAT 517005
Query 254 GGCCNNCTTT-ACCTTTTTAAGGGTATTTGATGCAGGCCACATGGTGCCCTATGATCAAC 312
|||| |||| |||||||| || ||| ||||| || || |||||||||||||||||||
Sbjct 517006 GGCC--CTTTCACCTTTTTGAGAATATACGATGCCGGTCATATGGTGCCCTATGATCAAC 517063
Query 313 CGGAGGCAAGTTTACAAATGGTTAACAGCTGGATTTCCGGTAA 355
||||||||||||| ||||||| ||||| ||||||||||||||
Sbjct 517064 CGGAGGCAAGTTTGGAAATGGTCAACAGTTGGATTTCCGGTAA 517106
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.28 0.460 0.850
Effective search space used: 6259637025
Query= gi|152022601|gb|CJ994912.1|CJ994912 CJ994912 normalized
Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus
cDNA clone B067-72 5', mRNA sequence
Length=555
***** No hits found *****
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.28 0.460 0.850
Effective search space used: 6466265820
Query= gi|152022600|gb|CJ994911.1|CJ994911 CJ994911 normalized
Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus
cDNA clone B067-68 5', mRNA sequence
Length=486
***** No hits found *****
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.28 0.460 0.850
Effective search space used: 5627596005
Query= gi|152022599|gb|CJ994910.1|CJ994910 CJ994910 normalized
Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus
cDNA clone B067-66 5', mRNA sequence
Length=544
***** No hits found *****
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.28 0.460 0.850
Effective search space used: 6332564835
Query= gi|152022597|gb|CJ994908.1|CJ994908 CJ994908 normalized
Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus
cDNA clone B067-61 5', mRNA sequence
Length=471
***** No hits found *****
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.28 0.460 0.850
Effective search space used: 5445276480
Query= gi|152022596|gb|CJ994907.1|CJ994907 CJ994907 normalized
Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus
cDNA clone B067-53 5', mRNA sequence
Length=511
***** No hits found *****
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.28 0.460 0.850
Effective search space used: 5931461880
Database: yeast.nt
Posted date: Feb 23, 2016 12:09 AM
Number of letters in database: 12,155,026
Number of sequences in database: 17
Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5
#!/bin/bash
#SBATCH --nodes=1
#SBATCH --ntasks-per-node=1
#SBATCH --mem=1gb
#SBATCH --time=00:15:00
#SBATCH --job-name=blast_nucleotide
#SBATCH --error=blast.%J.err
#SBATCH --output=blast.%J.out
#SBATCH --qos=short
module load blast/2.2.29
cp -R db/ /tmp
cp yeast.query /tmp
blastn -db /tmp/db/yeast.nt -query /tmp/yeast.query -out /tmp/blast_nucleotide.results
cp /tmp/blast_nucleotide.results .
>gi|152022604|gb|CJ994915.1|CJ994915 CJ994915 normalized Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus cDNA clone B067-89 5', mRNA sequence
CCACGCGTCCGAAGGAGTTGAGTTTATGGCGTTTGTGAAAGACAAAGACCACGTTAGAAACGAACCGACT
GGAAACCATTTCTTTTCAGAGAGTTTTGTATCATCTTCAATCGAAAAGGACCCTCCACTGGCATTTGACC
TATTGGTACACAGGAGAAGAATAACTGTTTATGAAACAAACATCGAGCCCATGATAGCCTTGCCGCTAGA
TCGACCAGTACTAGTCCATAACTATCTATGTGCTGCATTCAAGTTGTTGAGACAGCTGCCTTGCAAGGCA
ATCGCTAAGCTGTGGATAAAAATAATAGAGCCAAGGAAGAAGACGAGGTTCCCGTATATCAAAGGCGATG
CTAAGAAGCCGACATGGTGGCCCAAGGATGTGGAGCATAGAGAGCCGGACCACCTCAACAAAGCAGACCG
ACTGAATCTGATGTGCACCATAATAATGGATGTTTTGCCGCAGATGCCCCACAGCCTTGAAATGGTAGAC
GAGCTTGTGCGAGTGACTGTAGCAATGCCCATTTTCAAAAGGGAGAGCGTAAAGAAAGTCATCGTA
>gi|152022603|gb|CJ994914.1|CJ994914 CJ994914 normalized Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus cDNA clone B067-87 5', mRNA sequence
CCACGCGTCCGCTTACACTTATACAATATGGGGTTCTATCAAGGTGACGACGATGACACCGACACCAAGA
CATTTAACGACAAGTTCATCAAAGACCGGAAGTTCGCCACGGCTCCCTTCTGGAGCCTCTTCCCCAAGTT
GAAGGACATCGACGAGGACGATGACTCGCTCTTCCCGCTGCCCTTCAAGTTCGACTTCAAGGATTTTGGC
GACAATGCCTTCGCCATGGCATCAGGAATTCCGACCGTGAAGCAGTTCGACAAGTGCCAGGAGCTAAAGG
GCCAGTCCGCGTGGACAACCCAGGGCATTTGGAAGTGCCTAGTCCCCGGCCAAGCGATCCCTCCACTGCC
CAACCTGGACTTCCTCTTGCCGTTGGAAGACGTCCAGTCAGACAAGTCGCATTCCCGTGGGCTGTTCTTC
AACGACTTCAACCTTTTTTTGAAATGGAGATCGCACATGAACAAGCTGCAACAGCAAAGAACCATCAAGT
CCGCTGCCCTGGAACCCGTGGCTAGGACCCCGGAGGACCTCATGTTGAGCTGGGACGACTTGCATTT
>gi|152022602|gb|CJ994913.1|CJ994913 CJ994913 normalized Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus cDNA clone B067-83 5', mRNA sequence
CCACGGGTCCGCAGGATTTTTNTTTACTGGTGATGGTAGCAAACCATTTCAGCAATACGTTGCAGAACTT
TTAAATCACAATATTCCGGTATTGATCTATGCAGGTGATAAAGACTATATATGCAATTGGTTGGGAAATC
ACGCGTGGACTAATGAACTGGAGTGGATCAATAAATCTATGTATCAGAGGAGAAGGTTGAGATCATGGGT
TAGTGACGAAACTGGTGAAGAGTTTGGACAAGTCAAGAACTATGGCCNNCTTTACCTTTTTAAGGGTATT
TGATGCAGGCCACATGGTGCCCTATGATCAACCGGAGGCAAGTTTACAAATGGTTAACAGCTGGATTTCC
GGTAACCATGAATTTTCCAAGTCCTTTTCAAAACTCTAAAGTCTCACCTTTGAAAAGGTTGCTTGCGCTT
TTAGTACATCTATACTTCCATTCAGCTTTGTATTGACCACTTTTGGTTATCGTATCCTCTGTTAAATAGT
TAACTTTTTCTCCAGCTATAAGGTAATTTTCTATTTCAGAACGAAATA
>gi|152022601|gb|CJ994912.1|CJ994912 CJ994912 normalized Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus cDNA clone B067-72 5', mRNA sequence
CCACGCGTCCGGCAACACCAAGTTTGAAATTGCAATTTGCATTACCACATGAAACTTTATATAGTGGCTC
TGAAGTGACTCAAGTAAATCTGCCTGCTAAATCAGGACGTATTGGTGTTTTGGCCAACCACGTTCCTACT
GTTGAACAATTGCAACCAGGTGTCGTTGAAGTTATGGAAGGATCCAAGTCCAAGAAATTCTTCATATCTG
GTGGCTTTGCGACAGTTCAACCAGACTCACAATTGTGTGTGACTGCCATTGAAGCTTTCCCATTGGAATC
CTTTTCACAAGAGAATATAAAAAACTTACTAACAGAGGCCAAGAAAAATGCAAGTTCATCAGACGCTAGA
GAAGCCGCAGAAGCTGCAATCCAAATAGAAGTTTTAGAAGGCCTACAATCTGTGTTGAAGTAAAGTTTTC
TACATTACTCTTCCAAAACACAATGTACATTTTCTAAAAATAAGCGATCTGCTTGGGTGAATGAGGCGAA
AACTGTTGCTTATTTTTCTGCAAGGGCTTGCGATTTTTCTTTTGGCTTATGTCACGAATTATTCA
>gi|152022600|gb|CJ994911.1|CJ994911 CJ994911 normalized Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus cDNA clone B067-68 5', mRNA sequence
CCACGCGTCCGCCAGAATATTGTAAAAGGCCTGATTGAAATATTGAACGAAGCGAACCGAGAAGTGCCAG
CATTTTTAAATGATATGTCAAGGCAGAATCCAAGAGGTGGTAAAACTAGAGGTGGAGGCGGCGGAGGTTT
CTTCAATAACCGCAACAACAATTCAAGAGATTATCGTAAGCATGGGGGCAATGGTTCCTTTGGAAATACA
AGGCCAAGAAATACTGGAACATCAAACTGGGGTTCCAGCAGTGGGGGAGGGTTTAGGAACGATAATGAAA
ACAGTGGTTTTGGGAGTAGCAATGCTTCATGGTGGTAATAAGAAAAACTTGAGTACAGAGATGTTTTCCC
TTTCACTCCCACTACGCAAGCACACATCGATGTAAACTTTTTTTTCCGAATTCGCTTTACACTACCACTC
AAGTCCCTGATATAGGGCCCGATATTATTACTGTCTTTTTATTTTACTTTTTTTCTTTTTTCAAAA
>gi|152022599|gb|CJ994910.1|CJ994910 CJ994910 normalized Saccharomyces pastorianus cDNA libraries Saccharomyces pastorianus cDNA clone B067-66 5', mRNA sequence
CCACGCGTCCGATGGTGTGCGCCCTGGAGGCAGGCGCAGAGAATGTTTTCCACCACCGTTCCAATACAAG